Floyd Frodo Crypto Dog - Mix of German Shepard, St. Bernard, Grey Wolf, Rottweiler and French Bulldog
Floyd Frodo
  • Purity 29%
  • Age 17 months
  • Racing Exp 52
  • German Shepard 55%
  • Gold medal 1 Silver medal 3 Bronze medal 2
  • 17 races
  • Gen 6
Sad & Tardy

Achievements

Racer
Podium Champion
Speed Champion

Bio

Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I hate it when I am not the center of attention. I have a crush on the Grumpy cat. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 17 races
  • 1 3 2
 Best Time13.68 sec
No rank  RacingĀ *** LTC
35.3 % wins (6) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCACCCTCACACTGATCATCACGATGA
T
C
A
T
C
A
T
C
A
C
C
C
T
C
A
C
A
C
T
G
A
T
C
A
T
C
A
C
G
A
T
G
A
Genes: 777L7HB779B

Composition

German Shepard
55%
St. Bernard
18%
Grey Wolf
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality +7 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs Grey Wolf
Head German Shepard
Ears Rottweiler
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes French Bulldog
Color St. Bernard

Parents

No Children

Photos

Litecoin doggy race photo virtual dog racing crypto doggy race results online canine race podium crypto canine racing photo crypto canine race
Gift