Callisto Chase Bitcoin Dog - Mix of Labrador, Grey Wolf, German Shepard, Maltese, St. Bernard, Rottweiler, Boxer, Dachshund and Husky
Callisto Chase
  • Purity 3%
  • Age 12 months
  • Racing Exp 19
  • Labrador 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 6 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

It's a barkin' beautiful day! Callisto Chase here. I live inside of a Virtual machine two steps to the right from the firewall. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! Fun-loving and playful only need apply.

Racing Stats

Ran 6 races
  • 1 1 0
 Best Time14.67 sec
Rank 35  RacingĀ *** LTC
33.3 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAACCCCACCCTGACCACACAACCCCGGAACA
T
C
A
A
C
C
C
C
A
C
C
C
T
G
A
C
C
A
C
A
C
A
A
C
C
C
C
G
G
A
A
C
A
Genes: 7K5LB5HGLA4

Composition

Labrador
18%
Grey Wolf
18%
German Shepard
9%
Maltese
9%
St. Bernard
9%
Rottweiler
9%
Boxer
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality -6 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs Labrador
Front Legs Grey Wolf
Head St. Bernard
Ears Labrador
Snout Rottweiler
Mouth Boxer
Nose Grey Wolf
Eyes Dachshund
Color Husky

Parents

No Children

Photos

Bitcoin dog race results Bitcoin canine race results
Gift