Ricky Rufus Crypto Dog - Mix of Grey Wolf, Beagle, German Shepard, St. Bernard, Shiba Inu, Pug, Golder Retriever, Yorkshire Terrier and Corgi
Ricky Rufus
  • Purity 4%
  • Age 17 months
  • Racing Exp 11
  • Grey Wolf 27%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 2
Happy & Agile

Achievements

Racer

Bio

Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I've always wanted to be in commercials and be treated as the star I am!

Racing Stats

Ran 4 races
  • 1 0 0
 Best Time15.02 sec
Rank 50  RacingĀ *** LTC
25.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATCACCCTGAGTAGAACCCAGATTAAGCCCC
C
T
A
T
C
A
C
C
C
T
G
A
G
T
A
G
A
A
C
C
C
A
G
A
T
T
A
A
G
C
C
C
C
Genes: D7LBE2L8FOL

Composition

Grey Wolf
27%
Beagle
9%
German Shepard
9%
St. Bernard
9%
Shiba Inu
9%
Pug
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Grey Wolf
Front Legs St. Bernard
Head Shiba Inu
Ears Pug
Snout Grey Wolf
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes Corgi
Color Grey Wolf

Parents

No Children

Photos

virtual pet race podium
Gift