Ben Brian Crypto Dog - Mix of St. Bernard and Yorkshire Terrier
Ben Brian
  • Purity 82%
  • Age 17 months
  • Racing Exp 0
  • St. Bernard 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Sad & Tardy

Achievements

None

Bio

I'd like to take you for a byte to eat in cyberspace. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I love car rides when I can stick my head out the window. I'm hoping to find someone that doesn't mind the occasional gas after dinner!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGATGATGATGATGATGATGATGATTATGATGA
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
T
T
A
T
G
A
T
G
A
Genes: BBBBBBBBFBB

Composition

St. Bernard
91%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect +22 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs St. Bernard
Front Legs St. Bernard
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose Yorkshire Terrier
Eyes St. Bernard
Color St. Bernard