Noob Saibot Nakita Bitcoin Dog - Mix of St. Bernard, Corgi and Labrador
Noob Saibot Nakita
  • Purity 65%
  • Age 10 months
  • Racing Exp 0
  • St. Bernard 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Depressed & Snaillike

Achievements

None

Bio

How do you do? I'm Noob Saibot Nakita. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! My favorite place in the world is the dog park. So many smells!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing¬†*** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total¬†*** LTC

DNA Analysis

DNA Sequence: TGATGATGAAGCTGATGATGATGACCATGATGA
T
G
A
T
G
A
T
G
A
A
G
C
T
G
A
T
G
A
T
G
A
T
G
A
C
C
A
T
G
A
T
G
A
Genes: BBBOBBBB5BB

Composition

St. Bernard
82%
Corgi
9%
Labrador
9%

Current Energy

Vitality -39 points
Lunar Effect +20 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs St. Bernard
Front Legs Corgi
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose Labrador
Eyes St. Bernard
Color St. Bernard