Obi-Wan Olympia Crypto Game Dog - Mix of St. Bernard, German Shepard, Rottweiler and Schnauzer
Obi-Wan Olympia
  • Purity 52%
  • Age 6 months
  • Racing Exp 0
  • St. Bernard 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 6
Depressed & Snaillike

Achievements

None

Bio

My favorite game is Fetch except I never bring the ball back. My human says I'm loyal, intelligent, devoted and affectionate. Sometimes I just have to roll in something dead. You know the worst? Watching my humans 'get it on' when I've got no one.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGATGATCACACTGATGATGATGAATATGATGA
T
G
A
T
G
A
T
C
A
C
A
C
T
G
A
T
G
A
T
G
A
T
G
A
A
T
A
T
G
A
T
G
A
Genes: BB7HBBBBCBB

Composition

St. Bernard
73%
German Shepard
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs German Shepard
Front Legs Rottweiler
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose Schnauzer
Eyes St. Bernard
Color St. Bernard