Hawkeye Hanna Bitcoin Dog - Mix of St. Bernard, Border Collie, German Shepard, Husky and Schnauzer
Hawkeye Hanna
  • Purity 29%
  • Age 2 months
  • Racing Exp 0
  • St. Bernard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Sad & Snaillike

Achievements

None

Bio

Greetings. My name is Hawkeye Hanna. I live in cyberspace where you can turn me on. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I love the smell of freshly cut grass. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTGATCATACTGATGATGAACAATATGATGA
T
A
C
T
G
A
T
C
A
T
A
C
T
G
A
T
G
A
T
G
A
A
C
A
A
T
A
T
G
A
T
G
A
Genes: JB7JBBB4CBB

Composition

St. Bernard
55%
Border Collie
18%
German Shepard
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs German Shepard
Front Legs Border Collie
Head St. Bernard
Ears St. Bernard
Snout St. Bernard
Mouth Husky
Nose Schnauzer
Eyes St. Bernard
Color St. Bernard