Ice Ivy Digital Cryptocurrency Dog - Mix of Grey Wolf, Maltese, Labrador, Shiba Inu, Beagle, Poodle, Pug and Yorkshire Terrier
Ice Ivy
  • Purity 8%
  • Age 10 months
  • Racing Exp 0
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Happy & Quick

Achievements

None

Bio

I keep my well-built figure with zeros and ones. Power outages and computer viruses scare me! People food disagrees with me. Whew! You can tell. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACCCCTACCCACCACCGACGAATTACCACCA
G
T
A
C
C
C
C
T
A
C
C
C
A
C
C
A
C
C
G
A
C
G
A
A
T
T
A
C
C
A
C
C
A
Genes: ELDLKKI2F55

Composition

Grey Wolf
18%
Maltese
18%
Labrador
18%
Shiba Inu
9%
Beagle
9%
Poodle
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -40 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Grey Wolf
Legs Beagle
Front Legs Grey Wolf
Head Maltese
Ears Maltese
Snout Poodle
Mouth Pug
Nose Yorkshire Terrier
Eyes Labrador
Color Labrador