Buzzy Bloop Cryptocurrency Game Dog - Mix of Poodle, Labrador, Shiba Inu, Rottweiler, Maltese, Pug and Yorkshire Terrier
Buzzy Bloop
  • Purity 11%
  • Age 5 months
  • Racing Exp 0
  • Poodle 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Howdy there. I'm Buzzy Bloop. My favorite way to relax is to be scratched on my belly. I'm not a fan of sleeping on the floor. This body was made for cuddles! I'm a serial monogamist. I am really into starting howling wars with the neighborhood dogs. I'm the loudest!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGACCACGACACCGACCCAGAATTACCACCA
G
T
A
G
A
C
C
A
C
G
A
C
A
C
C
G
A
C
C
C
A
G
A
A
T
T
A
C
C
A
C
C
A
Genes: EIHIKI52F55

Composition

Poodle
27%
Labrador
27%
Shiba Inu
9%
Rottweiler
9%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Rottweiler
Front Legs Poodle
Head Maltese
Ears Poodle
Snout Labrador
Mouth Pug
Nose Yorkshire Terrier
Eyes Labrador
Color Labrador