Jago Jagger Litecoin Dog - Mix of Shiba Inu, Rottweiler and French Bulldog
Jago Jagger
  • Purity 65%
  • Age 8 months
  • Racing Exp 8
  • Shiba Inu 82%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

How goes it? I'm Jago Jagger. You can access my database anytime with your WiFi. As a perfectionist, I have to find just the right 'spot'. Dragging my butt on the carpet feels so good. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm just looking for some puppy love.

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time15.28 sec
Rank 54  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTACACGTAGTAGTAGTACGAGTAGTA
G
T
A
G
T
A
G
T
A
C
A
C
G
T
A
G
T
A
G
T
A
G
T
A
C
G
A
G
T
A
G
T
A
Genes: EEEHEEEE9EE

Composition

Shiba Inu
82%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -22 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Rottweiler
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose French Bulldog
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

cryptocurrency pet racing
Gift