Midnight Mary Jane Cryptocurrency Dog - Mix of Poodle, Grey Wolf, Beagle, Border Collie, Maltese, Shiba Inu and Labrador
Midnight Mary Jane
  • Purity 7%
  • Age 10 months
  • Racing Exp 0
  • Poodle 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Yo dog! Midnight Mary Jane here. I run exclusively on code. I never met a crotch or a butt I didn't like, but I'm just friendly that way. I like exploring off leash best. My favorite place in the world is the dog park. So many smells! I hate having to wear foo-foo clothes and ribbons in my fur.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACCCCCTACCCTACACCGACCTAGTAGACCCA
G
A
C
C
C
C
C
T
A
C
C
C
T
A
C
A
C
C
G
A
C
C
T
A
G
T
A
G
A
C
C
C
A
Genes: ILDLJKIDEI5

Composition

Poodle
27%
Grey Wolf
18%
Beagle
18%
Border Collie
9%
Maltese
9%
Shiba Inu
9%
Labrador
9%

Current Energy

Vitality -25 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Grey Wolf
Legs Beagle
Front Legs Grey Wolf
Head Border Collie
Ears Maltese
Snout Poodle
Mouth Beagle
Nose Shiba Inu
Eyes Poodle
Color Labrador