Bug Buffie Bitcoin Game Dog - Mix of Shiba Inu, French Bulldog, Beagle, Labrador, Labrador BK, Border Collie, Golder Retriever and German Shepard
Bug Buffie
  • Purity 9%
  • Age 8 months
  • Racing Exp 1
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Whatcha know, honey. Bug Buffie here. I'm willing to try little bondage, so my human chained me up! I love car rides when I can stick my head out the window. I love the smell of freshly cut grass. Finding the 'one' out of the pack that I can spend my life with...that's what I want.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.13 sec
Rank 75  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTACCAGTAGCACGACGAGTAGTATACAGATCA
C
T
A
C
C
A
G
T
A
G
C
A
C
G
A
C
G
A
G
T
A
G
T
A
T
A
C
A
G
A
T
C
A
Genes: D5E699EEJ87

Composition

Shiba Inu
27%
French Bulldog
18%
Beagle
9%
Labrador
9%
Labrador BK
9%
Border Collie
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -49 points
Lunar Effect -10 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Shiba Inu
Front Legs Labrador BK
Head French Bulldog
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose Border Collie
Eyes Golder Retriever
Color German Shepard

Parents

No Children

Photos

Gift