Ackbar Angus Cryptocurrency Dog - Mix of Pug, Shiba Inu, Golder Retriever, Boxer, Border Collie, Yorkshire Terrier, Pitbull terrier and Maltese
Ackbar Angus
  • Purity 12%
  • Age 3 months
  • Racing Exp 3
  • Pug 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Hey, good-looking! This is Ackbar Angus. The internet's my home. I love barking all night when others try to sleep. I don't understand why my human tries to give me tap water. I expect filtered and distilled! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time15.85 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGTAGAAAGAAACTACTTATCCACCGAAGAA
G
A
A
G
T
A
G
A
A
A
G
A
A
A
C
T
A
C
T
T
A
T
C
C
A
C
C
G
A
A
G
A
A
Genes: 2E28GJFNK22

Composition

Pug
36%
Shiba Inu
9%
Golder Retriever
9%
Boxer
9%
Border Collie
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Pug
Front Legs Golder Retriever
Head Boxer
Ears Border Collie
Snout Yorkshire Terrier
Mouth Pitbull terrier
Nose Maltese
Eyes Pug
Color Pug