Loretta Lark Bitcoin Dog - Mix of German Shepard, St. Bernard, Border Collie, Beagle, Labrador and Boxer
Loretta Lark
  • Purity 13%
  • Age 5 months
  • Racing Exp 10
  • German Shepard 36%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 4 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

What's up? I'm Loretta Lark. I'm having some new data architecture built for me, then I'd like to have you over to my place. I hate never catching that damn rabbit in my dreams. I like big butts, I cannot lie. I'm not looking to hook up forever, just to have a little fun.

Racing Stats

Ran 4 races
  • 0 1 0
 Best Time15.48 sec
No rank  RacingĀ *** LTC
25.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCATACTGATCATGACTACCATCAAAC
T
C
A
T
G
A
T
C
A
T
A
C
T
G
A
T
C
A
T
G
A
C
T
A
C
C
A
T
C
A
A
A
C
Genes: 7B7JB7BD57G

Composition

German Shepard
36%
St. Bernard
27%
Border Collie
9%
Beagle
9%
Labrador
9%
Boxer
9%

Current Energy

Vitality -19 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Border Collie
Head St. Bernard
Ears German Shepard
Snout St. Bernard
Mouth Beagle
Nose Labrador
Eyes German Shepard
Color Boxer

Parents

No Children

Photos

crypto canine racing results
Gift