Pepper Pickles Crypto Game Dog - Mix of Corgi, St. Bernard, German Shepard, Border Collie, Shiba Inu, Pug, Yorkshire Terrier, Golder Retriever and Dachshund
Pepper Pickles
  • Purity 4%
  • Age 14 months
  • Racing Exp 8
  • Corgi 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 1
Neutral & Lazy

Achievements

Racer

Bio

Nyan Cat is my best friend here in the cyberspace. I've been looking for love in all the wrong places... I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm into recreational spankings and a little 'ruff' play.

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time15.23 sec
No rank  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGAAGCTCATACGTAGAAAGCTTAAGCAGAGGA
T
G
A
A
G
C
T
C
A
T
A
C
G
T
A
G
A
A
A
G
C
T
T
A
A
G
C
A
G
A
G
G
A
Genes: BO7JE2OFO8A

Composition

Corgi
27%
St. Bernard
9%
German Shepard
9%
Border Collie
9%
Shiba Inu
9%
Pug
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Corgi
Legs German Shepard
Front Legs Border Collie
Head Shiba Inu
Ears Pug
Snout Corgi
Mouth Yorkshire Terrier
Nose Corgi
Eyes Golder Retriever
Color Dachshund

Parents

No Children

Photos

virtual canine race
Gift