Peaches Pupperino Bitcoin Dog - Mix of Corgi, Pug, St. Bernard, German Shepard, Shiba Inu, Schnauzer, Yorkshire Terrier, Golder Retriever and Grey Wolf
Peaches Pupperino
  • Purity 3%
  • Age 2 months
  • Racing Exp 12
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 7 races
  • Gen 0
Sad & Snaillike

Achievements

Racer

Bio

Hey dawg! I'm Peaches Pupperino. I hate being left alone all day. People food disagrees with me. Whew! You can tell. I'm into recreational spankings and a little 'ruff' play. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! Getting out of a long relationship, not looking for another

Racing Stats

Ran 7 races
  • 0 0 1
 Best Time15.02 sec
No rank  RacingĀ *** LTC
14.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGAAGCTCAGAAGTAGAAATATTAAGCAGACCC
T
G
A
A
G
C
T
C
A
G
A
A
G
T
A
G
A
A
A
T
A
T
T
A
A
G
C
A
G
A
C
C
C
Genes: BO72E2CFO8L

Composition

Corgi
18%
Pug
18%
St. Bernard
9%
German Shepard
9%
Shiba Inu
9%
Schnauzer
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Grey Wolf
9%

Current Energy

Vitality -11 points
Lunar Effect -8 points

Traits Breakdown

Body St. Bernard
Tail Corgi
Legs German Shepard
Front Legs Pug
Head Shiba Inu
Ears Pug
Snout Schnauzer
Mouth Yorkshire Terrier
Nose Corgi
Eyes Golder Retriever
Color Grey Wolf