Laika Lincoln Crypto Dog - Mix of Pug, Rottweiler, Poodle, Corgi, Border Collie and Dachshund
Laika Lincoln
  • Purity 20%
  • Age 15 months
  • Racing Exp 51
  • Pug 45%
  • Gold medal 0 Silver medal 3 Bronze medal 3
  • 18 races
  • Gen 0
Sad & Slothful

Achievements

Racer

Bio

I never knew my father. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 18 races
  • 0 3 3
 Best Time14.67 sec
No rank  RacingĀ *** LTC
33.3 % wins (6) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACGAAGAAGACAGCTACGAACACGGAGAAGAA
C
A
C
G
A
A
G
A
A
G
A
C
A
G
C
T
A
C
G
A
A
C
A
C
G
G
A
G
A
A
G
A
A
Genes: H22IOJ2HA22

Composition

Pug
45%
Rottweiler
18%
Poodle
9%
Corgi
9%
Border Collie
9%
Dachshund
9%

Current Energy

Vitality -55 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Poodle
Head Corgi
Ears Border Collie
Snout Pug
Mouth Rottweiler
Nose Dachshund
Eyes Pug
Color Pug