Bada Bing Litecoin Game Dog - Mix of Beagle, French Bulldog, Poodle, Dachshund, German Shepard, Pug, Pitbull terrier and Labrador
Bada Bing
  • Purity 8%
  • Age 6 months
  • Racing Exp 0
  • Beagle 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Yo dog! Bada Bing here. Taking a break from chasing Nyan Cat around cyberspace. I like giving wet kisses. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I cry whenever I hear an ambulance siren! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACGGACTATCAGAACGATCCCCACTACTACGA
G
A
C
G
G
A
C
T
A
T
C
A
G
A
A
C
G
A
T
C
C
C
C
A
C
T
A
C
T
A
C
G
A
Genes: IAD729N5DD9

Composition

Beagle
27%
French Bulldog
18%
Poodle
9%
Dachshund
9%
German Shepard
9%
Pug
9%
Pitbull terrier
9%
Labrador
9%

Current Energy

Vitality -48 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Dachshund
Legs Beagle
Front Legs German Shepard
Head Pug
Ears French Bulldog
Snout Pitbull terrier
Mouth Labrador
Nose Beagle
Eyes Beagle
Color French Bulldog

Parents

No Children

Gift