Field Goal Fred Bitcoin Game Dog - Mix of Border Collie, Poodle, Labrador BK, Corgi, Boxer, Schnauzer and Maltese
Field Goal Fred
  • Purity 16%
  • Age 16 months
  • Racing Exp 0
  • Border Collie 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Casual

Achievements

None

Bio

It's a barkin' beautiful day! Field Goal Fred here. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm always up for some puppy action, is that wrong? I like it when you're frisky. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Fun-loving and playful only need apply.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACTACTACGCATACAGCTACAACATATACACC
G
A
C
T
A
C
T
A
C
G
C
A
T
A
C
A
G
C
T
A
C
A
A
C
A
T
A
T
A
C
A
C
C
Genes: IJJ6JOJGCJK

Composition

Border Collie
45%
Poodle
9%
Labrador BK
9%
Corgi
9%
Boxer
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Poodle
Tail Border Collie
Legs Border Collie
Front Legs Labrador BK
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Boxer
Nose Schnauzer
Eyes Border Collie
Color Maltese