Betsy Burger Crypto Dog - Mix of Schnauzer, Border Collie, Poodle, Grey Wolf, Labrador BK, Corgi, Dachshund, Beagle and Maltese
Betsy Burger
  • Purity 3%
  • Age 6 months
  • Racing Exp 1
  • Schnauzer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Spiked dog collars really turn me on. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I'm into chasing fast cars, squirrels and my tail. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from??

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.13 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACCCCATAGCATACAGCTACGGAATACTAACC
G
A
C
C
C
C
A
T
A
G
C
A
T
A
C
A
G
C
T
A
C
G
G
A
A
T
A
C
T
A
A
C
C
Genes: ILC6JOJACDK

Composition

Schnauzer
18%
Border Collie
18%
Poodle
9%
Grey Wolf
9%
Labrador BK
9%
Corgi
9%
Dachshund
9%
Beagle
9%
Maltese
9%

Current Energy

Vitality -28 points
Lunar Effect -10 points

Traits Breakdown

Body Poodle
Tail Grey Wolf
Legs Schnauzer
Front Legs Labrador BK
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Dachshund
Nose Schnauzer
Eyes Beagle
Color Maltese