Paddington Pete Digital Cryptocurrency Dog - Mix of Beagle, Corgi, Golder Retriever, Grey Wolf, Yorkshire Terrier, Border Collie, St. Bernard, Husky and Pug
Paddington Pete
  • Purity 7%
  • Age 3 months
  • Racing Exp 0
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hello, I'm Paddington Pete. How's it goin'? Taking a break from chasing Nyan Cat around cyberspace. I'm a serial monogamist. My favorite thing is to sit in my humans' laps while they are trying to read or drive. My turn-offs are rolled up newspapers and loud noises.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTACTAAGACCCTTATACTGAACAAGCAGCGAA
C
T
A
C
T
A
A
G
A
C
C
C
T
T
A
T
A
C
T
G
A
A
C
A
A
G
C
A
G
C
G
A
A
Genes: DD8LFJB4OO2

Composition

Beagle
18%
Corgi
18%
Golder Retriever
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Border Collie
9%
St. Bernard
9%
Husky
9%
Pug
9%

Current Energy

Vitality -32 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Beagle
Legs Golder Retriever
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Border Collie
Snout St. Bernard
Mouth Husky
Nose Corgi
Eyes Corgi
Color Pug

Parents

No Children

Gift