Blizzard Bella Litecoin Dog - Mix of Yorkshire Terrier, Schnauzer, French Bulldog, Shiba Inu, Pug, Pitbull terrier and Maltese
Blizzard Bella
  • Purity 16%
  • Age 5 months
  • Racing Exp 26
  • Yorkshire Terrier 45%
  • Gold medal 0 Silver medal 0 Bronze medal 3
  • 11 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I run on the information superhighway and haven't been hit by a car yet. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I hate it when my humans fart and they blame me! I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 11 races
  • 0 0 3
 Best Time15.05 sec
No rank  RacingĀ *** LTC
27.3 % wins (3) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATATTACGATTATTAGTAGAATTATCCACCTTA
A
T
A
T
T
A
C
G
A
T
T
A
T
T
A
G
T
A
G
A
A
T
T
A
T
C
C
A
C
C
T
T
A
Genes: CF9FFE2FNKF

Composition

Yorkshire Terrier
45%
Schnauzer
9%
French Bulldog
9%
Shiba Inu
9%
Pug
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -50 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Yorkshire Terrier
Legs French Bulldog
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Shiba Inu
Snout Pug
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes Maltese
Color Yorkshire Terrier

Parents

No Children

Photos

virtual dog race podium virtual dog racing results Litecoin doggy racing
Gift