Charlotte Cookie Litecoin Dog - Mix of Yorkshire Terrier, Shiba Inu and Schnauzer
Charlotte Cookie
  • Purity 65%
  • Age 10 months
  • Racing Exp 0
  • Yorkshire Terrier 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

I live behind a firewall in the Machine. I don't like having to stay off the furniture. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I've always wanted to be in commercials and be treated as the star I am!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTAGTATTATTATTATTATTAATATTATTATTA
T
T
A
G
T
A
T
T
A
T
T
A
T
T
A
T
T
A
T
T
A
A
T
A
T
T
A
T
T
A
T
T
A
Genes: FEFFFFFCFFF

Composition

Yorkshire Terrier
82%
Shiba Inu
9%
Schnauzer
9%

Current Energy

Vitality -44 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs Yorkshire Terrier
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Schnauzer
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Yorkshire Terrier