Jelly Jackie Crypto Dog - Mix of Yorkshire Terrier, Pitbull terrier, Shiba Inu, St. Bernard, Poodle, Husky, Schnauzer, Pug and Beagle
Jelly Jackie
  • Purity 4%
  • Age 10 months
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

You know the worst? Watching my humans 'get it on' and I have to lick myself. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTATCCGTATTATGAGACACAATAGAATTACTA
T
T
A
T
C
C
G
T
A
T
T
A
T
G
A
G
A
C
A
C
A
A
T
A
G
A
A
T
T
A
C
T
A
Genes: FNEFBI4C2FD

Composition

Yorkshire Terrier
27%
Pitbull terrier
9%
Shiba Inu
9%
St. Bernard
9%
Poodle
9%
Husky
9%
Schnauzer
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pitbull terrier
Legs Shiba Inu
Front Legs Yorkshire Terrier
Head St. Bernard
Ears Poodle
Snout Husky
Mouth Schnauzer
Nose Pug
Eyes Yorkshire Terrier
Color Beagle