Minnie Miss Havisham Litecoin Dog - Mix of French Bulldog, Shiba Inu, Beagle, St. Bernard, Golder Retriever, Yorkshire Terrier, Rottweiler, Pug, Border Collie and Schnauzer
Minnie Miss Havisham
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. My favorite position is doggie style ;) I'm sick of having my nails clipped, those are to help me dig! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACTACGATGAAGATTACACGAATACCGAATA
G
T
A
C
T
A
C
G
A
T
G
A
A
G
A
T
T
A
C
A
C
G
A
A
T
A
C
C
G
A
A
T
A
Genes: ED9B8FH2J9C

Composition

French Bulldog
18%
Shiba Inu
9%
Beagle
9%
St. Bernard
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Rottweiler
9%
Pug
9%
Border Collie
9%
Schnauzer
9%

Current Energy

Vitality -53 points
Lunar Effect +8 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs French Bulldog
Front Legs St. Bernard
Head Golder Retriever
Ears Yorkshire Terrier
Snout Rottweiler
Mouth Pug
Nose Border Collie
Eyes French Bulldog
Color Schnauzer