Chiquita Cyrus Litecoin Dog - Mix of French Bulldog, Labrador, Husky, German Shepard, Pug, Shiba Inu, Beagle, Rottweiler and Boxer
Chiquita Cyrus
  • Purity 5%
  • Age 8 months
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

Hey, good-looking! This is Chiquita Cyrus. Once you go digital, baby, you never go back. I like big butts, I cannot lie. I hate having to share my food dish... My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing¬†*** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total¬†*** LTC

DNA Analysis

DNA Sequence: ACATCAGAAGTACGACTACACAACCGACCACCA
A
C
A
T
C
A
G
A
A
G
T
A
C
G
A
C
T
A
C
A
C
A
A
C
C
G
A
C
C
A
C
C
A
Genes: 472E9DHG955

Composition

French Bulldog
18%
Labrador
18%
Husky
9%
German Shepard
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality -50 points
Lunar Effect -6 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Pug
Front Legs Shiba Inu
Head French Bulldog
Ears Beagle
Snout Rottweiler
Mouth Boxer
Nose French Bulldog
Eyes Labrador
Color Labrador