Freddie Fuzzy Digital Cryptocurrency Dog - Mix of French Bulldog, Golder Retriever, Boxer and Border Collie
Freddie Fuzzy
  • Purity 43%
  • Age 2 months
  • Racing Exp 0
  • French Bulldog 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 9
Sad & Snaillike

Achievements

None

Bio

Hey dawg! I'm Freddie Fuzzy. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. Chasing anything that will run is so much fun, I could do that all day. My human says I'm loyal, intelligent, devoted and affectionate.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGACGACGACGACGAAGAAGAAACCGATACCGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
A
G
A
A
G
A
A
A
C
C
G
A
T
A
C
C
G
A
Genes: 9999988G9J9

Composition

French Bulldog
64%
Golder Retriever
18%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -4 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Golder Retriever
Snout Golder Retriever
Mouth Boxer
Nose French Bulldog
Eyes Border Collie
Color French Bulldog