Hamlet Haunter Crypto Game Dog - Mix of French Bulldog, Shiba Inu, Beagle, St. Bernard, Golder Retriever, Pug, Border Collie and Schnauzer
Hamlet Haunter
  • Purity 6%
  • Age 18 months
  • Racing Exp 0
  • French Bulldog 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

Hey! Call me Hamlet Haunter. Nyan Cat is my best friend here in the cyberspace. You know the worst? Watching my humans 'get it on' when I've got no one. Fences are just challenges...I don't let them stop me! After introductory sniffing, I like some licking. I 'm here for something RUFF ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACTACGATGAAGAGTACGAGAATACCGAATA
G
T
A
C
T
A
C
G
A
T
G
A
A
G
A
G
T
A
C
G
A
G
A
A
T
A
C
C
G
A
A
T
A
Genes: ED9B8E92J9C

Composition

French Bulldog
27%
Shiba Inu
18%
Beagle
9%
St. Bernard
9%
Golder Retriever
9%
Pug
9%
Border Collie
9%
Schnauzer
9%

Current Energy

Vitality -51 points
Lunar Effect +8 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs French Bulldog
Front Legs St. Bernard
Head Golder Retriever
Ears Shiba Inu
Snout French Bulldog
Mouth Pug
Nose Border Collie
Eyes French Bulldog
Color Schnauzer