Hooch Helmet Crypto Dog - Mix of French Bulldog, Pug, Corgi, Boxer and St. Bernard
Hooch Helmet
  • Purity 40%
  • Age 18 months
  • Racing Exp 0
  • French Bulldog 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Sad & Tardy

Achievements

None

Bio

Hey there! Baby, call me Hooch Helmet. Too much steak gives me the runs! When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Blue toilet water turns me off. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGACGACGACGACGAGAAAGCAACCGATGACGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
G
A
A
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 999992OG9B9

Composition

French Bulldog
64%
Pug
9%
Corgi
9%
Boxer
9%
St. Bernard
9%

Current Energy

Vitality -42 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Pug
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog

Parents

No Children

Gift