Jabba Jenny Bitcoin Dog - Mix of French Bulldog, Boxer, Corgi and St. Bernard
Jabba Jenny
  • Purity 41%
  • Age 6 months
  • Racing Exp 1
  • French Bulldog 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 7
Depressed & Snaillike

Achievements

Racer

Bio

They call me Jabba Jenny. What's your name? I'm 100% digital, baby. My bark alone scares birds out of my yard. Long or short hair works for me, just no baldies please. My favorite game is Fetch except I never bring the ball back. I'll outrun you for the ball if I can...that's just how I roll.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.18 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGACGACGACGACGAAACAGCAACCGATGACGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 99999GOG9B9

Composition

French Bulldog
64%
Boxer
18%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -42 points
Lunar Effect -6 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog