Kernal Kipper Bitcoin Dog - Mix of Pug, Border Collie, Labrador, Husky, French Bulldog, Labrador BK, Shiba Inu, Poodle, St. Bernard and Grey Wolf
Kernal Kipper
  • Purity 1%
  • Age 6 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I never knew my father. I hate it when my human runs out of poop-bags. How embarrassing! You'll find me walking into my favorite pet store like I own the place. I do, don't I? I'm trying to find a partner in crime to help me dig through the trash for the good stuff.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGAACCAACACGAGCAGTAGACGAATGACCC
T
A
C
G
A
A
C
C
A
A
C
A
C
G
A
G
C
A
G
T
A
G
A
C
G
A
A
T
G
A
C
C
C
Genes: J25496EI2BL

Composition

Pug
18%
Border Collie
9%
Labrador
9%
Husky
9%
French Bulldog
9%
Labrador BK
9%
Shiba Inu
9%
Poodle
9%
St. Bernard
9%
Grey Wolf
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Labrador
Front Legs Husky
Head French Bulldog
Ears Labrador BK
Snout Shiba Inu
Mouth Poodle
Nose Pug
Eyes St. Bernard
Color Grey Wolf

Parents

No Children

Gift