Whispy Wesley Litecoin Game Dog - Mix of French Bulldog, Pug, Corgi, Boxer and Maltese
Whispy Wesley
  • Purity 40%
  • Age 4 months
  • Racing Exp 8
  • French Bulldog 64%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

As a good digital dog, my humans give me virtually everything. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! Removing excess stuffing from pillows is my favorite hobby. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets.

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time14.35 sec
No rank  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGACGACGACGACGAGAAAGCAACCGAACCCGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
G
A
A
A
G
C
A
A
C
C
G
A
A
C
C
C
G
A
Genes: 999992OG9K9

Composition

French Bulldog
64%
Pug
9%
Corgi
9%
Boxer
9%
Maltese
9%

Current Energy

Vitality -44 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Pug
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes Maltese
Color French Bulldog