Legolas Louie Litecoin Game Dog - Mix of French Bulldog, Boxer, Maltese, Rottweiler, Corgi and St. Bernard
Legolas Louie
  • Purity 18%
  • Age 12 months
  • Racing Exp 0
  • French Bulldog 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Tardy

Achievements

None

Bio

My favorite pastime is playing tug-of-war with my human's underwear. Watching kids play without me is the worst, no? I'm willing to try little bondage, so my human chained me up! I love unconditionally. New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAACCCGACACCGAAACAGCAACCGATGACGA
C
G
A
A
C
C
C
G
A
C
A
C
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 9K9H9GOG9B9

Composition

French Bulldog
45%
Boxer
18%
Maltese
9%
Rottweiler
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -40 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs French Bulldog
Front Legs Rottweiler
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog