Nori Nugget Crypto Dog - Mix of French Bulldog, Corgi, Boxer, Maltese, Border Collie, Rottweiler and St. Bernard
Nori Nugget
  • Purity 7%
  • Age 6 months
  • Racing Exp 1
  • French Bulldog 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

I answer to 'Nori Nugget'. Someday I'm gonna breakout from inside this server. I am a proud show dog. I like showing off my perfect coat! I'm into leather...if I have the right partner. If you are tall enough to reach the door handle, I 'specially wanna meet you.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.95 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCACCTACCACCGAAACAGCAACCGATGACGA
A
G
C
A
C
C
T
A
C
C
A
C
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: OKJH9GOG9B9

Composition

French Bulldog
27%
Corgi
18%
Boxer
18%
Maltese
9%
Border Collie
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Maltese
Legs Border Collie
Front Legs Rottweiler
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog