Quan Chi Quarterback Litecoin Dog - Mix of Corgi, French Bulldog, Maltese, Dachshund, Pug, Schnauzer, Husky, St. Bernard and Golder Retriever
Quan Chi Quarterback
  • Purity 5%
  • Age 2 months
  • Racing Exp 1
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 2
Sad & Snaillike

Achievements

Racer

Bio

I've been known to take mega bytes when playing ruff. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! Trust me. Leashes, collar and whips can be fun if you know what you're doing. Don't bother contacting me if you like cats.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.38 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCACCCGACGAGGAGAAAGCATAACATGAAGA
A
G
C
A
C
C
C
G
A
C
G
A
G
G
A
G
A
A
A
G
C
A
T
A
A
C
A
T
G
A
A
G
A
Genes: OK99A2OC4B8

Composition

Corgi
18%
French Bulldog
18%
Maltese
9%
Dachshund
9%
Pug
9%
Schnauzer
9%
Husky
9%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -9 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Maltese
Legs French Bulldog
Front Legs French Bulldog
Head Dachshund
Ears Pug
Snout Corgi
Mouth Schnauzer
Nose Husky
Eyes St. Bernard
Color Golder Retriever