Bear Bug Cryptocurrency Dog - Mix of Schnauzer, Pug, Beagle, Yorkshire Terrier, Labrador, Grey Wolf, Corgi, St. Bernard, German Shepard and French Bulldog
Bear Bug
  • Purity 1%
  • Age 14 months
  • Racing Exp 1
  • Schnauzer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Neutral & Lazy

Achievements

Racer

Bio

Howdy potential partner! Bear Bug here. Here in cyberspace, I ain't got much use for a floppy disc. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I'm trying to find a partner in crime to help me dig through the trash for the good stuff.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.35 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAACTATTACCACCCAGCATATGAATATCACGA
G
A
A
C
T
A
T
T
A
C
C
A
C
C
C
A
G
C
A
T
A
T
G
A
A
T
A
T
C
A
C
G
A
Genes: 2DF5LOCBC79

Composition

Schnauzer
18%
Pug
9%
Beagle
9%
Yorkshire Terrier
9%
Labrador
9%
Grey Wolf
9%
Corgi
9%
St. Bernard
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality -48 points
Lunar Effect +2 points

Traits Breakdown

Body Pug
Tail Beagle
Legs Yorkshire Terrier
Front Legs Labrador
Head Grey Wolf
Ears Corgi
Snout Schnauzer
Mouth St. Bernard
Nose Schnauzer
Eyes German Shepard
Color French Bulldog

Parents

No Children

Photos

Gift