Raven Rosco Bitcoin Dog - Mix of Labrador BK, Labrador, Poodle, Corgi, Beagle, St. Bernard, Golder Retriever and Pug
Raven Rosco
  • Purity 6%
  • Age 2 months
  • Racing Exp 21
  • Labrador BK 27%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 9 races
  • Gen 0
Sad & Snaillike

Achievements

Racer

Bio

I have a crush on the Grumpy cat. As a designer, I suggest low windows or couch backs next to windows without curtains. I love waking up early then indulging in long afternoon naps. As long as we are headed in the same direction, I say we try hanging out for a while.

Racing Stats

Ran 9 races
  • 1 0 1
 Best Time14.33 sec
No rank  RacingĀ *** LTC
22.2 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACGCAAGCGCACCACTATGAAGACCAGAAGCA
G
A
C
G
C
A
A
G
C
G
C
A
C
C
A
C
T
A
T
G
A
A
G
A
C
C
A
G
A
A
G
C
A
Genes: I6O65DB8526

Composition

Labrador BK
27%
Labrador
18%
Poodle
9%
Corgi
9%
Beagle
9%
St. Bernard
9%
Golder Retriever
9%
Pug
9%

Current Energy

Vitality -3 points
Lunar Effect +10 points

Traits Breakdown

Body Poodle
Tail Labrador BK
Legs Corgi
Front Legs Labrador BK
Head Labrador
Ears Beagle
Snout St. Bernard
Mouth Golder Retriever
Nose Labrador
Eyes Pug
Color Labrador BK

Parents

No Children

Photos

online doggy race photo cryptocurrency dog racing
Gift