Aggie Abigail Cryptocurrency Dog - Mix of Border Collie, Husky, Rottweiler, Schnauzer and Dachshund
Aggie Abigail
  • Purity 38%
  • Age 4 months
  • Racing Exp 161
  • Border Collie 64%
  • Gold medal 5 Silver medal 11 Bronze medal 4
  • 40 races
  • Gen 1
Depressed & Snaillike

Achievements

Podium Champion
Speed Champion
Pro Racer
Master Champion

Bio

Pleased to meet you! My name's Aggie Abigail. I'm into recreational spankings and a little 'ruff' play. I hate being left alone all day. My favorite position is doggie style ;) I'll eat my vomit and yours too. If you are looking for companionship without commitment, so am I.

Racing Stats

Ran 40 races
  • 5 11 4
 Best Time13.50 sec
No rank  RacingĀ *** LTC
50.0 % wins (20) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACTACACATACTACCACATATACGGATAC
T
A
C
T
A
C
T
A
C
A
C
A
T
A
C
T
A
C
C
A
C
A
T
A
T
A
C
G
G
A
T
A
C
Genes: JJJ4JJHCJAJ

Composition

Border Collie
64%
Husky
9%
Rottweiler
9%
Schnauzer
9%
Dachshund
9%

Current Energy

Vitality -1 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Husky
Head Border Collie
Ears Border Collie
Snout Rottweiler
Mouth Schnauzer
Nose Border Collie
Eyes Dachshund
Color Border Collie