Kain Kermit Bitcoin Dog - Mix of Corgi, Shiba Inu, German Shepard, Dachshund, Yorkshire Terrier and Border Collie
Kain Kermit
  • Purity 9%
  • Age 8 months
  • Racing Exp 9
  • Corgi 27%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

My AI may be artificial, but at least I'm intelligent. Let me have a pig's ear and I'm in heaven. I've been looking for love in all the wrong places... I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...

Racing Stats

Ran 3 races
  • 0 1 0
 Best Time14.85 sec
Rank 55  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATTATCATACAGCTCAAGCGTAGGAAGCGGA
G
T
A
T
T
A
T
C
A
T
A
C
A
G
C
T
C
A
A
G
C
G
T
A
G
G
A
A
G
C
G
G
A
Genes: EF7JO7OEAOA

Composition

Corgi
27%
Shiba Inu
18%
German Shepard
18%
Dachshund
18%
Yorkshire Terrier
9%
Border Collie
9%

Current Energy

Vitality -31 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs German Shepard
Front Legs Border Collie
Head Corgi
Ears German Shepard
Snout Corgi
Mouth Shiba Inu
Nose Dachshund
Eyes Corgi
Color Dachshund

Parents

No Children

Photos

virtual dog race results
Gift