Crush Casper Crypto Dog - Mix of Grey Wolf, German Shepard, Husky, Border Collie, Pug, Rottweiler, Schnauzer, French Bulldog and St. Bernard
Crush Casper
  • Purity 5%
  • Age 5 months
  • Racing Exp 17
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 7 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Yo! I'm Crush Casper and I'd like to rock your world. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! If you are looking for companionship without commitment, keep looking.

Racing Stats

Ran 7 races
  • 0 0 2
 Best Time14.82 sec
No rank  RacingĀ *** LTC
28.6 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCCCCTCAACATACGAACACATATCACGATGA
C
C
C
C
C
C
T
C
A
A
C
A
T
A
C
G
A
A
C
A
C
A
T
A
T
C
A
C
G
A
T
G
A
Genes: LL74J2HC79B

Composition

Grey Wolf
18%
German Shepard
18%
Husky
9%
Border Collie
9%
Pug
9%
Rottweiler
9%
Schnauzer
9%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality +3 points
Lunar Effect -10 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs German Shepard
Front Legs Husky
Head Border Collie
Ears Pug
Snout Rottweiler
Mouth Schnauzer
Nose German Shepard
Eyes French Bulldog
Color St. Bernard

Parents

No Children

Photos

cryptocurrency canine racing podium virtual dog racing
Gift