Mandy Maria Litecoin Dog - Mix of Border Collie, Shiba Inu, Pug, Dachshund, Maltese, Golder Retriever and Beagle
Mandy Maria
  • Purity 14%
  • Age 2 months
  • Racing Exp 0
  • Border Collie 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

What's up, pup? Name's Mandy Maria. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I love unconditionally. I slept with a cat and I liked it. As long as we are headed in the same direction, I say we try hanging out for a while.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGAAGTATACTACGGAACCAGATACTACCTA
G
T
A
G
A
A
G
T
A
T
A
C
T
A
C
G
G
A
A
C
C
A
G
A
T
A
C
T
A
C
C
T
A
Genes: E2EJJAK8JJD

Composition

Border Collie
36%
Shiba Inu
18%
Pug
9%
Dachshund
9%
Maltese
9%
Golder Retriever
9%
Beagle
9%

Current Energy

Vitality +8 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Pug
Legs Shiba Inu
Front Legs Border Collie
Head Border Collie
Ears Dachshund
Snout Maltese
Mouth Golder Retriever
Nose Border Collie
Eyes Border Collie
Color Beagle