Bolt Brigadier Cryptocurrency Dog - Mix of Shiba Inu, Husky, German Shepard, Golder Retriever, Rottweiler, Yorkshire Terrier and Boxer
Bolt Brigadier
  • Purity 9%
  • Age 15 months
  • Racing Exp 34
  • Shiba Inu 27%
  • Gold medal 1 Silver medal 0 Bronze medal 3
  • 12 races
  • Gen 4
Sad & Slothful

Achievements

Racer
Speed Champion

Bio

I enjoy staying active, and running circles around puppies and young children. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Sometimes I forget where I buried my bone. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 12 races
  • 1 0 3
 Best Time13.68 sec
No rank  RacingĀ *** LTC
33.3 % wins (4) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCAACAAGAGTAGTACACTCATTAAACGTA
A
C
A
T
C
A
A
C
A
A
G
A
G
T
A
G
T
A
C
A
C
T
C
A
T
T
A
A
A
C
G
T
A
Genes: 4748EEH7FGE

Composition

Shiba Inu
27%
Husky
18%
German Shepard
18%
Golder Retriever
9%
Rottweiler
9%
Yorkshire Terrier
9%
Boxer
9%

Current Energy

Vitality -10 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Husky
Front Legs Golder Retriever
Head Shiba Inu
Ears Shiba Inu
Snout Rottweiler
Mouth German Shepard
Nose Yorkshire Terrier
Eyes Boxer
Color Shiba Inu

Parents

No Children

Photos

crypto doggy racing results cryptocurrency dog race online pet racing podium virtual dog racing
Gift