Timothy Thor Litecoin Dog - Mix of Labrador, Poodle, Grey Wolf, Shiba Inu, French Bulldog, German Shepard, Border Collie and Corgi
Timothy Thor
  • Purity 6%
  • Age 3 months
  • Racing Exp 2
  • Labrador 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi, Timothy Thor is my name. Currently, I live on the information superhighway. I'm always up for some puppy action, is that wrong? I enjoy crunchy kibble and drinking from toilets. Halloween costumes are the worst, I hate 'em! Eat, sleep, poop. Honey, I've got it made.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time15.42 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACCACCAGACCGACCCGACTCATACCCCAGC
G
T
A
C
C
A
C
C
A
G
A
C
C
G
A
C
C
C
G
A
C
T
C
A
T
A
C
C
C
C
A
G
C
Genes: E55I9LI7JLO

Composition

Labrador
18%
Poodle
18%
Grey Wolf
18%
Shiba Inu
9%
French Bulldog
9%
German Shepard
9%
Border Collie
9%
Corgi
9%

Current Energy

Vitality -34 points
Lunar Effect -12 points

Traits Breakdown

Body Shiba Inu
Tail Labrador
Legs Labrador
Front Legs Poodle
Head French Bulldog
Ears Grey Wolf
Snout Poodle
Mouth German Shepard
Nose Border Collie
Eyes Grey Wolf
Color Corgi