Muffy Marky Mark Cryptocurrency Dog - Mix of German Shepard, Husky, Border Collie, Labrador BK, Pug, Shiba Inu and Schnauzer
Muffy Marky Mark
  • Purity 9%
  • Age 15 months
  • Racing Exp 157
  • German Shepard 27%
  • Gold medal 8 Silver medal 6 Bronze medal 6
  • 35 races
  • Gen 0
Sad & Slothful

Achievements

Podium Champion
Pro Racer
Master Champion
Speed Champion

Bio

I've been known to take mega bytes when playing ruff. I like it when you're frisky. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Trust me. Leashes, collar and whips can be fun if you know what you're doing.

Racing Stats

Ran 35 races
  • 8 6 6
 Best Time13.78 sec
No rank  RacingĀ *** LTC
57.1 % wins (20) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAACATCAACATACGAAGTAATATACTCATCA
G
C
A
A
C
A
T
C
A
A
C
A
T
A
C
G
A
A
G
T
A
A
T
A
T
A
C
T
C
A
T
C
A
Genes: 6474J2ECJ77

Composition

German Shepard
27%
Husky
18%
Border Collie
18%
Labrador BK
9%
Pug
9%
Shiba Inu
9%
Schnauzer
9%

Current Energy

Vitality -5 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs German Shepard
Front Legs Husky
Head Border Collie
Ears Pug
Snout Shiba Inu
Mouth Schnauzer
Nose Border Collie
Eyes German Shepard
Color German Shepard