Copernicus Chewbarka Litecoin Dog - Mix of Pug, Shiba Inu, German Shepard, Golder Retriever, Boxer, Yorkshire Terrier, Pitbull terrier, Maltese and Schnauzer
Copernicus Chewbarka
  • Purity 4%
  • Age 15 months
  • Racing Exp 0
  • Pug 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Slothful

Achievements

None

Bio

I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. Rolling around on the carpet after a bath is my favorite way to dry. I'm totally against baths! They are the worst! Just looking to sow some wild oats here...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGTATCAAGAAACGAATTATCCACCGAAATA
G
A
A
G
T
A
T
C
A
A
G
A
A
A
C
G
A
A
T
T
A
T
C
C
A
C
C
G
A
A
A
T
A
Genes: 2E78G2FNK2C

Composition

Pug
27%
Shiba Inu
9%
German Shepard
9%
Golder Retriever
9%
Boxer
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -39 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs German Shepard
Front Legs Golder Retriever
Head Boxer
Ears Pug
Snout Yorkshire Terrier
Mouth Pitbull terrier
Nose Maltese
Eyes Pug
Color Schnauzer