Legolas Leather Bitcoin Dog - Mix of Border Collie, Schnauzer, Husky, Pug, Dachshund, Maltese, Golder Retriever and Grey Wolf
Legolas Leather
  • Purity 8%
  • Age 8 months
  • Racing Exp 6
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 0
Happy & Quick

Achievements

Racer

Bio

How you doin? ;) Legolas Leather here. Shy dogs that tuck tail bore me. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.87 sec
Rank 81  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAGAAATATACATAGGAACCAGATACTACCCC
A
C
A
G
A
A
A
T
A
T
A
C
A
T
A
G
G
A
A
C
C
A
G
A
T
A
C
T
A
C
C
C
C
Genes: 42CJCAK8JJL

Composition

Border Collie
27%
Schnauzer
18%
Husky
9%
Pug
9%
Dachshund
9%
Maltese
9%
Golder Retriever
9%
Grey Wolf
9%

Current Energy

Vitality -21 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail Pug
Legs Schnauzer
Front Legs Border Collie
Head Schnauzer
Ears Dachshund
Snout Maltese
Mouth Golder Retriever
Nose Border Collie
Eyes Border Collie
Color Grey Wolf