Adelaide Ashes Bitcoin Game Dog - Mix of Schnauzer, Boxer, Pitbull terrier, St. Bernard, Labrador, Golder Retriever and Border Collie
Adelaide Ashes
  • Purity 14%
  • Age 6 months
  • Racing Exp 0
  • Schnauzer 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 9
Depressed & Snaillike

Achievements

None

Bio

My name is Adelaide Ashes and I do tricks. I'm all about a hard drive because you can't do anything with a floppy disc. I live life by my favorite quote "Every dog has it's day", but every day is my day! I like never worrying about my dog poo. I've got people for that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACATAATAATATCCAACTGACCAAGATACATA
A
A
C
A
T
A
A
T
A
A
T
A
T
C
C
A
A
C
T
G
A
C
C
A
A
G
A
T
A
C
A
T
A
Genes: GCCCNGB58JC

Composition

Schnauzer
36%
Boxer
18%
Pitbull terrier
9%
St. Bernard
9%
Labrador
9%
Golder Retriever
9%
Border Collie
9%

Current Energy

Vitality -50 points
Lunar Effect -12 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Pitbull terrier
Ears Boxer
Snout St. Bernard
Mouth Labrador
Nose Golder Retriever
Eyes Border Collie
Color Schnauzer