Rowdy Rose Crypto Dog - Mix of Pug, Labrador BK, Labrador, Poodle, Husky, Shiba Inu, St. Bernard, Grey Wolf, Border Collie and French Bulldog
Rowdy Rose
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I never knew my father. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I just want to "share a bone"... ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACCAGACACAGTAGAAGAATGACCCTACCGA
G
C
A
C
C
A
G
A
C
A
C
A
G
T
A
G
A
A
G
A
A
T
G
A
C
C
C
T
A
C
C
G
A
Genes: 65I4E22BLJ9

Composition

Pug
18%
Labrador BK
9%
Labrador
9%
Poodle
9%
Husky
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Border Collie
9%
French Bulldog
9%

Current Energy

Vitality -14 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador
Legs Poodle
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pug
Mouth St. Bernard
Nose Grey Wolf
Eyes Border Collie
Color French Bulldog

Parents

No Children

Gift