Zeke Zilch Litecoin Dog - Mix of Boxer, Beagle, Shiba Inu, Yorkshire Terrier, Border Collie, Rottweiler and St. Bernard
Zeke Zilch
  • Purity 9%
  • Age 10 months
  • Racing Exp 1
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I answer to 'Zeke Zilch'. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Rolling around on the carpet after a bath is my favorite way to dry. It turns me on when I can show an older dog a new trick. I'd like to help you shed your coat, baby.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.62 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTATACAACAACCTAAACGTACACTGACTAGTA
T
T
A
T
A
C
A
A
C
A
A
C
C
T
A
A
A
C
G
T
A
C
A
C
T
G
A
C
T
A
G
T
A
Genes: FJGGDGEHBDE

Composition

Boxer
27%
Beagle
18%
Shiba Inu
18%
Yorkshire Terrier
9%
Border Collie
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality -47 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Border Collie
Legs Boxer
Front Legs Boxer
Head Beagle
Ears Boxer
Snout Shiba Inu
Mouth Rottweiler
Nose St. Bernard
Eyes Beagle
Color Shiba Inu