Jynx Jake Digital Cryptocurrency Dog - Mix of French Bulldog, Maltese, Corgi, Grey Wolf, Labrador BK, St. Bernard, German Shepard and Shiba Inu
Jynx Jake
  • Purity 6%
  • Age 3 months
  • Racing Exp 7
  • French Bulldog 27%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'm having some new data architecture built for me, then I'd like to have you over to my place. I'll eat my vomit and yours too. I enjoy exploration and am game for anything doggy-style. I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.55 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCCGACCCCGAACCGCATGATCAGTAACCCGA
A
G
C
C
G
A
C
C
C
C
G
A
A
C
C
G
C
A
T
G
A
T
C
A
G
T
A
A
C
C
C
G
A
Genes: O9L9K6B7EK9

Composition

French Bulldog
27%
Maltese
18%
Corgi
9%
Grey Wolf
9%
Labrador BK
9%
St. Bernard
9%
German Shepard
9%
Shiba Inu
9%

Current Energy

Vitality -32 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs Grey Wolf
Front Legs French Bulldog
Head Maltese
Ears Labrador BK
Snout St. Bernard
Mouth German Shepard
Nose Shiba Inu
Eyes Maltese
Color French Bulldog